Utilization of Milk Processing by Product (Whey) as Based of Edible Film Making with Glycerol Adding as Plasticizer

Abstract: The research on the utilization of milk processing by product (whey) as based edible film making with glycerol adding as plasticizer has been done. Two thousand milliliters of whey is added to ethanol 95% (1:1) and heated to 60°C and then added as much as 1 % of the CMC and then treated with the addition of glycerol as much as 2.5 % (A), 3 % (B), 3.5 % (C), 4 % (D) and 4.5 % (E) in randomized block design with five replications. This research aims to determine the effect of adding glycerol to the characteristics of the edible film. The Variable was observed in this research were the moisture, protein, pH, thickness, viscosity and shelf life of the edible film. Result of the research showed that the higher glycerol plasticizer adding was decreased of moisture and protein content significantly (p<0.01) and increased pH, thickness and shelf life of the edible film. The use of glycerol plasticizer as much as 4 % is the optimum in producing good edible film. Key words: Whey, edible film, plasticizer, glycero

POTENSI ISOLAT BAKTERI ASAM LAKTAT DARI SUSU KERBAU SEBAGAI PROBIOTIK DAN PENGHASIL BAKTERIOSIN UNTUK PANGAN FUNGSIONAL

Pangan fungsional merupakan pangan yang mengandung komponen aktif yang dapat memberikan manfaat bagi kesehatan. Tidak terjaminnya keamanan pangan yang ada saat ini, akibat tidak terkendalinya penggunaan bahan kimia saat pengolahan, maka dapat diprediksi bahwa permintaan pangan fungsional akan meningkat pada masa yang akan datang Salah satunya adalah pemanfaatan bakteri asam laktat (BAL) yang diisolasi dari susu kerbau di Sumatera Barat sebagai sumber probiotik dan biopreservatif untuk pangan fungsional. Penelitian ini meliputi 4 tahapan yaitu : 1). Isolasi dan identifikasi BAL yang memiliki zona hambat terbesar terhadap bakteri patogen, 2). Pengujian isolat BAL yang berpotensi sebagai probiotik, 3). Karakteristik bakteriosin isolat BAL, dan 4). Aplikasi isolat BAL sebagai probiotik dan biopreservatif untuk pangan fungsional. Metode penelitian yang digunakan adalah metode deskriptif dan eksperimen. Hasil penelitian tahap 1, adalah diperoleh 5 isolat BAL dari kabupaten di Sumatera Barat (Kabupaten Agam, Kabupaten Tanah Datar, Kabupaten 50 Kota, Kabupaten Solok dan Kabupaten Sijunjung ) yang memiliki daya hambat terbesar terhadap bakteri patogen (Escherechia coli O157 : H7, Staphylococcus aureus ATCC25923, dan Listeria monocytogenes CFSAN004330 yaitu isolat SKA 3.3, SKTD 7.2, SKP 1.1, SKS 1.1 dan SKSJ 4.2. Selanjutnya kelima isolat tersebut diuji kemampuannya sebagai probiotik. Hasil penelitian tahap 2, adalah dihasilkan satu isolat sebagai kandidat probiotik yaitu SKA 3.3, yang memiliki kemampuan tahan terhadap pH 2 selama 90 dan 180 menit, tahan terhadap garam empedu (Oxgall) 0,3% dan 0,5% selama 5 jam, resisten terhadap antibiotik (amphicillin 10μg, chloramphenicol 30μg, erytromicine 15μg, penicillin 10μg dan tetracycline 30 μg) dan memiliki pesentase hidrophobisitas 55,492% ± 0,823. Hasil penelitian tahap 3, adalah karakteristik bakteriosin yang dihasilkan oleh Lactobacillus fermentum L23 yang merupakan hasil identifikasi secara molekuler dengan 16S rRNA dengan primer 27F AGAGTTTGATCCTGGCTGAG dan primer 1492R GTTTACCTTACGACTT yang telah dibandingkan dengan data Gene Bank menggunakan program BLAST di NCBI (http://www.ncbi.nlm.nih.gov). Lactobacillus fermentum L23 memiliki aktivitas antimikroba dengan diameter zona bening 10 mm terhadap Staphylococcus aureus ATCC25923 dan 20 mm terhadap Listeria monocytogenes CFSAN004330, memiliki aktivitas antibakteri terhadap Staphylococcus aureus ATCC25923, dan Listeria monocytogenes CFSAN004330) pada pH 2-7, tahan pada suhu 40,60,80 dan 100oC selama 60 menit, dan dapat dilisis oleh enzim protease-K dan tripsin. Hasil penelitian tahap 4, adalah aplikasi L. fermentum L23 yang dikombinasikan dengan Streptococcus thermophilus (starter 5%) sebagai yogurt probiotik, yang ditambah dengan ekstrak buah naga (2%) sebagai prebiotik dan memiliki aktivitas antioksidan hingga 44,142%, yang berfungsi sebagai pangan fungsional. Yogurt probiotik ini memenuhi Standar Nasional Indonesia (SNI) No. 2981-2009, dengan total bakteri asam laktat 14,6 x 108CFU/ml, sesuai dengan persyaratan jumlah sel hidup probiotik dalam susu fermentasi yang ditetapkan oleh codex (2011). Aplikasi bakteriosin pada sosis, mampu memperpanjang masa simpan hingga 12 hari pada konsentrasi bakteriosin 0,6%, yang mampu menekan pertumbuhan total koloni bakteri aerob mejadi 5,0 x 103CFU/ml dan kualitas sosis yang dihasilkan masih memenuhi Standar Nasional Indonesia (SNI : 3820-2015). Kata kunci : bakteri asam laktat, susu kerbau, bakteriosin, probiotik dan ekstrak buah naga

The Effect of Work Motivation, Work Discipline and Leadership on Employee Performance at the Public Works, Spatial Planning and Land Office of South Solok Regency

This research aims to determine the effect of work motivation on employee performance at Public Works, Spatial Planning and Land Office of South Solok. The influence of work discipline on the performance of employees in the Public Works, Spatial and Land Office of South Solok Regency, Effect of Leadership on Employee Performance at the Department of Public Works, Spatial Planning and Land of South Solok and the influence of work motivation, work discipline and leadership on performance at the Department of Employment General, Spatial and Land Affairs of South Solok Regency. The sample used was 51 people against employees of the Public Works, Spatial and Land Office of South Solok Regency. The analysis used in this study is multiple linear regression which measures the effect of independent variables on the dependent variable. The results of this research indicate that motivation has a significant effect on the performance of employees of the Public Works, Spatial Planning and Land Office of South Solok, Work discipline does not have a significant effect on Performance at the Public Works, Spatial and Land Office of South Solok Regency, Leadership has a significant effect on employee performance Public Works, Spatial Planning and Land Office of South Solok Regency and Motivation, Work Discipline and Leadership influence the performance of employees of the Public Works, Spatial and Land Office of South Solok Regency

PROGRAM PENDAMPINGAN DAN PELATIHAN PENELITIAN TINDAKAN KELAS DENGAN MENERAPKAN MODEL PEMBELAJARAN PROBLEM BASED LEARNING DI SMPN 1 LUMPO

The focus of this study is to analyze the problem-based learning model that can be applied to students holistically or holistically. The method used in this study is data collection on program implementation, workshops to improve teacher pedagogic competence in implementing problem based learning models, mentoring in classroom action research training, building cooperative relationships between partners and the Education Office at the District and Provincial levels and evaluation. The results of the study show that the learning process still depends on concrete objects and experiences experienced directly. The first problem that arises is the teacher, the second problem is learning activities, and the third problem is learning resources and learning models. While the solution is that the teacher is able to find a learning model that matches the results of the research and observations made by the teacher at school. The preparations carried out include: preparation of learning, implementation of learning, and evaluation of learning processes and outcomes

Persepsi Guru Terhadap Modul Media Pembelajaran Motorik Halus Pada Anak Usia Dini Se-Gugus Mawar Merah Kota Bengkulu

Tujuan penelitian adalah mendeskripsikan persepsi guru terhadap modul media pembelajaran motorik halus pada anak usia dini Se-Gugus Mawar Merah Kota Bengkulu. Penelitian ini menggunakan pendekatan kuantitatif dengan jenis metode deskriptif survei. Populasi dalam penelitian ini adalah guru yang berada di PAUD Se-Gugus Mawar Merah Kota Bengkulu yang berjumlah 31 orang guru. Penentuan sampel dalam penelitian ini menggunakan nonprobability sampling total, dimana semua anggota populasi digunakan sebagai sampel yang berjumlah 31 guru se-gugus Mawar Merah Kota Bengkulu. Data penelitian ini dikumpulkan dengan menggunakan angket. Data yang terkumpul dianalisis menggunakan analisis statistik dengan rumus rata-rata. Hasil penelitian menunjukkan bahwa guru se-gugus Mawar Merah Kota Bengkulu mempersepsikan modul media pembelajaran motorik halus  sesuai dengan kriteria kelayakan modul dengan nilai rata-rata 3,18. Saran dari penelitian ini guru PAUD dapat menerapkan modul tersebut sebagai media dalam proses pembelajaran untuk menstimulasi perkembangan motorik halus anak. Selain itu bagi peneliti berikutnya untuk mengembangkan kegiatan dalam modul agar modul bisa digunakan dalam pembelajaran satu semester dan meneliti penggunaan modul dalam pembelajaran di PAUD